View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2973_low_6 (Length: 231)
Name: NF2973_low_6
Description: NF2973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2973_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 19 - 212
Target Start/End: Original strand, 34956810 - 34957003
Alignment:
| Q |
19 |
aaacatgtaattgctgctattaagaaagttcgtgctctatccgaaaaggctgatggagggtatgatatgaggctggaaatgaattcttttgttaccaaac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34956810 |
aaacatgtaattgctgctattaagaaagttcgttctctttccgaaaaggccgatggagggtatgatatgaggctggaaatgaattcttttgttaccaaac |
34956909 |
T |
|
| Q |
119 |
ttacttttaaggagatgtgtgttgttcttaaggaacaaaaagggtggagacaagttagggatttctttgcttggatgaaaatgcaggtctttct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34956910 |
ttacttttaaggagatgtgtgttgttcttaaggaacaaaaagggtggagacaagttagggatttctttgcttggatgaaaatgcaggtctttct |
34957003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University