View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2974_low_16 (Length: 226)
Name: NF2974_low_16
Description: NF2974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2974_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 119 - 213
Target Start/End: Original strand, 5569695 - 5569789
Alignment:
| Q |
119 |
caataattaacaaatgagcttgtaatggtgcctataattgttaccaattatgtcaatttccgttgccccattggtaactcttccggttgggcctt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5569695 |
caataattaacaaatgagcttgtaatggtgcctataattgttaccaattatgtcaatttccgttgccccattggtaaatcttccggttgggcctt |
5569789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 5569576 - 5569628
Alignment:
| Q |
1 |
attgcttatctttcatacttgtttt-ataagaatgagttagatccaatataat |
52 |
Q |
| |
|
||||||||| |||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
5569576 |
attgcttatttttcatacttatttttataagaatgagttagatccaatataat |
5569628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University