View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2975_high_21 (Length: 275)
Name: NF2975_high_21
Description: NF2975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2975_high_21 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 130 - 275
Target Start/End: Original strand, 32581422 - 32581568
Alignment:
| Q |
130 |
cttttccatcattgttccgagaaccttcgacaaactaaatatgttgcgtgaacaattgtctccaatgtgattaacctaaatttgtcact-atagctatca |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
32581422 |
cttttccatcattgttccgagaaccttcgacaaactaaatatgttgcgtgaacaattgcctccaatgtgattaacctagatttgtcactgatagctatca |
32581521 |
T |
 |
| Q |
229 |
tgatgcttaatatcgatggtagcactcaaattaatacagttaatcat |
275 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||| |||||||||| |
|
|
| T |
32581522 |
tgatgcttaatatccatggtagtactcaaattaatatagttaatcat |
32581568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 26 - 82
Target Start/End: Complemental strand, 2238089 - 2238033
Alignment:
| Q |
26 |
accaccacctctccactataacccaccatcaccatcgtcctcctcaccaccatcctt |
82 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
2238089 |
accaccacctcaccaccgtaacccaccatcaccatcgtcctcctcaccgccaccctt |
2238033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University