View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2975_high_25 (Length: 251)

Name: NF2975_high_25
Description: NF2975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2975_high_25
NF2975_high_25
[»] chr7 (1 HSPs)
chr7 (1-232)||(33835287-33835519)


Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 33835519 - 33835287
Alignment:
1 aacttttacatagttactaagttgttaatgaatcgaactctgactcttcttcttcctctcccttcgagcttccacttctgacttgatagaaggttgagga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||    
33835519 aacttttacatagttactaagttgttaatgaatcgaactctgactcttcttcttcctctccctccgagcttccacttctaacttgatagaaggttgagga 33835420  T
101 atatctcaaccaaggtatctttatgacctccccatagtctgtgattggttagcgcccgttaaggatagaccttcttgctttagaatatcccccatcctac 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33835419 atatctcaaccaaggtatctttatgacctccccatagtctgtgattggttagcgcccgttaaggatagaccttcttgctttagaatatcccccatcctac 33835320  T
201 gactaatgatgtgagat-gctaactcaactaga 232  Q
    ||||||| ||||||||| |||||||||||||||    
33835319 gactaattatgtgagatggctaactcaactaga 33835287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University