View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2975_high_31 (Length: 247)
Name: NF2975_high_31
Description: NF2975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2975_high_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 7506283 - 7506143
Alignment:
| Q |
1 |
ctcactagagtaactccctatatatagacacacattctgtgtgagtgtgtgtcagttgaacttagatatagtaacttaactctcaattgagagtcaatgt |
100 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7506283 |
ctcactagagtcactcccaatatatagacacacattctgtgtgagt----------tgaacttagatatagtaacttaactctcaattgagactcaatgt |
7506194 |
T |
|
| Q |
101 |
gccaaagtaattaaacaaagttacgtacataggcttgtgcacgtctttggt |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
7506193 |
gccaaagtaattaaacaaagttacgtacataggcttgtgcacatctatggt |
7506143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 146 - 240
Target Start/End: Complemental strand, 7506102 - 7506008
Alignment:
| Q |
146 |
tttggtgctaatattttggcattgatcctaaacttctagttggagttgtaatgacatattggtggtgaaagaaacattattttgcttagtctctg |
240 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7506102 |
tttggtgctaataatttggcattgatcctaaacttctagttggagttgtaatgacatattggtggtgaaagaaacattattttgcttagtctctg |
7506008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University