View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2975_high_32 (Length: 237)
Name: NF2975_high_32
Description: NF2975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2975_high_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 43255287 - 43255075
Alignment:
| Q |
1 |
catttacatgatctttctcttttgctcgaaacacaatctctgtctcgactgagcgtcccccaccgaaaccaccacctcatgtgaaacagatcctccactt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || || | || || |||||| |||||||||||||||||||||| |
|
|
| T |
43255287 |
catttacatgatctttctcttttgctcgaaacacaatctctgtctcgaccgaccg------agcgt--cccccaccttatgtgaaacagatcctccactt |
43255196 |
T |
 |
| Q |
101 |
tggtctaccggatctgccatcgccgtctattttgaaacttgtctcggcatcctatccaccatcgctgcccagccttgtacggccgccgcgaaagcctccc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43255195 |
tggtctaccggatctgccatcgccgtctattttgaaacttgtctcggcatcctatccaccatcgctgcccagccttgtatggccgccgcgaaagcctccc |
43255096 |
T |
 |
| Q |
201 |
gaagaatttcgaacaactttg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
43255095 |
gaagaatttcgaacaactttg |
43255075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University