View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2975_low_12 (Length: 367)
Name: NF2975_low_12
Description: NF2975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2975_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 4e-60; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 175 - 351
Target Start/End: Complemental strand, 1819519 - 1819349
Alignment:
| Q |
175 |
tttgttgtttcgaatttgaccaagattcatccnnnnnnnnttcgtatccaagattcataatcacacaagtatatagctctttcatggttgatcaccatat |
274 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1819519 |
tttgttgtttcgaattggaccaagattcatccaaaaaaaattcgtatccaagattcataatcacacaagtatatagctttttcatggttgatcaccatat |
1819420 |
T |
 |
| Q |
275 |
gatgcagccataccagcaacagcaagaggatgttcaacaaattacaaatcactcaacgaaattttctcccaattttt |
351 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1819419 |
gatgcagccatac------cggcaagaggatgttcaacaaattacaaatcactcaacgaaattttctcccaattttt |
1819349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 12 - 120
Target Start/End: Complemental strand, 1819682 - 1819574
Alignment:
| Q |
12 |
atgaataattaagataagataatatctaagtagggtggatatagatccacatgagatggtttttccttcttctatacaaaatttaaatcaatatcgattc |
111 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1819682 |
atgaataattaagataagataatatataagtagggtggatatagatccacatgagatggtttttccttcttctatacaaaatttaaatcaatatcgattc |
1819583 |
T |
 |
| Q |
112 |
acttgaagc |
120 |
Q |
| |
|
||||||||| |
|
|
| T |
1819582 |
acttgaagc |
1819574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University