View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2975_low_15 (Length: 349)
Name: NF2975_low_15
Description: NF2975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2975_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 5 - 348
Target Start/End: Complemental strand, 33835939 - 33835596
Alignment:
| Q |
5 |
gtaaaataagttgtttgattgactaaattttatctatagtgaaatttacaaatggtatttatagaccaatgaaatttataagtgatgcaaatgattaatt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33835939 |
gtaaaataagttgtttgattgactaaattttatttatagtgaaatttacaaatggtatttatagaccaatgaaatttataagtgatgcaaatgattaatt |
33835840 |
T |
|
| Q |
105 |
acctacactttatgatgcaaactagttgacaagctacatttgtctcactcgccaacgactaagtgagttattaagctcctcgaacgaattaccctaacga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33835839 |
acctacactttatgatgcaaactagttgacaagctacatttgtctcactcaccaacgactaagtgagttattaagctcctcgaatgaattaccctaacga |
33835740 |
T |
|
| Q |
205 |
taatttatgatttctcaactaaaattttgattgatcttcttccacgctgatagcacaatttctctttaaataagtatagttgatttgccctaaccgcctt |
304 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33835739 |
taatttatgatttctcagctaaaattttgattgatcttcttccacgctgatagcacaatttctctttaaataagtatagttgatttgccctaaccgcctt |
33835640 |
T |
|
| Q |
305 |
tgatatattagctttctttctctgttctttgtcttgctatcttt |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33835639 |
tgatatattagctttctttctctgttctttgtcttgctatcttt |
33835596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University