View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2975_low_17 (Length: 296)

Name: NF2975_low_17
Description: NF2975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2975_low_17
NF2975_low_17
[»] chr3 (1 HSPs)
chr3 (52-183)||(32581712-32581846)


Alignment Details
Target: chr3 (Bit Score: 109; Significance: 7e-55; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 52 - 183
Target Start/End: Complemental strand, 32581846 - 32581712
Alignment:
52 gcagcttcgatttatttttacttgtcaatcggtgttgtgtttattagggtacacagtacgatttcaggtctcaactctttctctctcta---ctacactc 148  Q
    ||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||    
32581846 gcagcttcgatgtatttttacttgtcaatcggtgttgcgtttattagggtacacagtacgatttcaggtctcaactctttctctctctactactacactc 32581747  T
149 ccaactgctaaactccactccactccaatacttcg 183  Q
    |||||||||||||||||||||||||||| ||||||    
32581746 ccaactgctaaactccactccactccaacacttcg 32581712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University