View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2975_low_17 (Length: 296)
Name: NF2975_low_17
Description: NF2975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2975_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 7e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 52 - 183
Target Start/End: Complemental strand, 32581846 - 32581712
Alignment:
| Q |
52 |
gcagcttcgatttatttttacttgtcaatcggtgttgtgtttattagggtacacagtacgatttcaggtctcaactctttctctctcta---ctacactc |
148 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32581846 |
gcagcttcgatgtatttttacttgtcaatcggtgttgcgtttattagggtacacagtacgatttcaggtctcaactctttctctctctactactacactc |
32581747 |
T |
 |
| Q |
149 |
ccaactgctaaactccactccactccaatacttcg |
183 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
32581746 |
ccaactgctaaactccactccactccaacacttcg |
32581712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University