View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2975_low_23 (Length: 263)
Name: NF2975_low_23
Description: NF2975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2975_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 15 - 204
Target Start/End: Original strand, 5718657 - 5718846
Alignment:
| Q |
15 |
acattttccatcattttttacttctactatcaacacgtttcttctcttgtttgtttccattcttcttagaacaacttttgcttccatgatcttgcttatc |
114 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
5718657 |
acatttttcatcattttttacttctactatcaacacgtttcttctcttgtttgtttccattcttcttagaacaactcttgcttccatgatcttgtttatc |
5718756 |
T |
 |
| Q |
115 |
tttcttcaaccccgactttccttgtccgcgaccataatttgtttgatgttgataattcattggaccggacgaagcatccgaagccatcga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5718757 |
tttcttcaaccccgactttccttgtccgcgaccataatttgtttgatgttgataattcattggaccggacgaagcatccgaagccatcga |
5718846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University