View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2975_low_30 (Length: 250)
Name: NF2975_low_30
Description: NF2975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2975_low_30 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 14 - 250
Target Start/End: Original strand, 31641095 - 31641331
Alignment:
| Q |
14 |
gaaggtatataagagaaacaatgctaaagatgaattgaatggccaaatatacccatggtaattttggtctctaacagttcccccacgactcaggaacagt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31641095 |
gaaggtatataagagaaacaatgctaaagatgaattgaatggccaaatatacccatggtaattttggtgtctaacagttcccccacgactcaggaacagt |
31641194 |
T |
 |
| Q |
114 |
tgttgtcccaagaaaaccaaaacctgcttgttgtgactgtgacttgagcatcatcatgttttgatgaggttggtgttggtggtattctacaccccccgtg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31641195 |
tgttgtcccaagaaaaccaaaacctgcttgttgtgactgtgacttgagcatcatcatgttttgatgaggttggtgttggtggtattctacaccccccgtg |
31641294 |
T |
 |
| Q |
214 |
aatgttagcatatcctttacatccaaggagtcaccac |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31641295 |
aatgttagcatatcctttacatccaaggagtcaccac |
31641331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University