View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2975_low_40 (Length: 226)
Name: NF2975_low_40
Description: NF2975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2975_low_40 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 21 - 208
Target Start/End: Complemental strand, 3548761 - 3548574
Alignment:
| Q |
21 |
aatgtgatgaactaaacatatggggagaacaaagagaatgnnnnnnnnnacctccatgattgaaccatccttggatttctgctgtgttggaaccatttca |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3548761 |
aatgtgatgaactaaacatatggggagaacaaagagaatgtttttttttacctccatgattgaaccatccttggatttctgctgtgttggaaccatttca |
3548662 |
T |
|
| Q |
121 |
acaacgtaatcggtgaccgaaagaagccaatcaatttcttttctccatcttgctttcctttccggtggcattggctctaggcgctttt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3548661 |
acaacgtaatcggtgaccgaaagaagccaatcaatttcttttctccatcttgctttcctttccggtggcattggctctaggcgctttt |
3548574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 85 - 208
Target Start/End: Original strand, 43812533 - 43812656
Alignment:
| Q |
85 |
ccatccttggatttctgctgtgttggaaccatttcaacaacgtaatcggtgaccgaaagaagccaatcaatttcttttctccatcttgctttcctttccg |
184 |
Q |
| |
|
|||||||| ||||| ||||||| ||||||||||||||||| ||||| ||||| || |||||| |||||||||||||||||||||||||||||||||| | |
|
|
| T |
43812533 |
ccatccttagatttttgctgtgaaggaaccatttcaacaacataatctgtgactgatagaagcaaatcaatttcttttctccatcttgctttcctttctg |
43812632 |
T |
|
| Q |
185 |
gtggcattggctctaggcgctttt |
208 |
Q |
| |
|
||||||||| ||||||||||||| |
|
|
| T |
43812633 |
ctggcattggttctaggcgctttt |
43812656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University