View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2977_high_16 (Length: 250)
Name: NF2977_high_16
Description: NF2977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2977_high_16 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 61 - 250
Target Start/End: Original strand, 40675868 - 40676061
Alignment:
| Q |
61 |
tcccggtaatttgtttactttctgatgcattttacaagtgatcttgctgctaatctctct----ggtgtagaagcattacttacacactggtatcctgaa |
156 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||| |||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
40675868 |
tcccggtaatttgtctactttctgatgcattttacaagtgatcctgccgctaatctctctagtacgtgtagaagcattacttacacactagtatcctgaa |
40675967 |
T |
 |
| Q |
157 |
tttaagatgtttctgtaagatagtgtcatggctacctggccaaaagtcaaggaattggccgagacaatatctgaacactcatgttgtgcccttc |
250 |
Q |
| |
|
||| |||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40675968 |
tttgagatgtttctgttagatagtgtcatagctacctggccaaaagtcaaggaattggccgagacaaattctgaacactcatgttgtgcccttc |
40676061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University