View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2977_high_21 (Length: 243)
Name: NF2977_high_21
Description: NF2977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2977_high_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 5 - 225
Target Start/End: Original strand, 31858091 - 31858330
Alignment:
| Q |
5 |
gtgcatgtgagatattattcataggatgttatggcttcaactattatttttgctgcttctgtactcttggtattcatataacctgtaggtgaagtatctt |
104 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31858091 |
gtgcatgtgagatattattcattggatgttatggcttcaactattatttttgctgcttccgtactcttggtattcatataacctgtaggtgaagtatctt |
31858190 |
T |
|
| Q |
105 |
atat-------------------tggtctcaaaatcataactagggcactgttctgattgaacgtcaaaattatgcaaagaaaggagtatttcaaaatga |
185 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31858191 |
atatctaacattgtctctgaacctggtctcaaaatcacaactagggcactgttctgattgaacgtcaaagttatgcaaagaaaggagtatttcaaaatga |
31858290 |
T |
|
| Q |
186 |
tggttgatcgaggtaagaaaaaccgatggtggtgtgtact |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31858291 |
tggttgatcgaggtaagaaaaaccgatggtggtgtgtact |
31858330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University