View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2977_high_23 (Length: 227)
Name: NF2977_high_23
Description: NF2977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2977_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 15 - 189
Target Start/End: Complemental strand, 32856536 - 32856362
Alignment:
| Q |
15 |
cacagattcacaatctcactttcactgtcatagaacagagtcctccgccacaaccgtagcggcatcaggtatatcttccactgccatctctttcagtgaa |
114 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32856536 |
cacagattcacaatctcactctcaccgtcatagaacagagtcctccgccacaaccgtagcggcatcaggtatatcttccactgccatctctttcagtgaa |
32856437 |
T |
 |
| Q |
115 |
ttgctggttagttagggtttctgctttgagtgtgaactctaacagatctctgtgcatctaagttcttcatgttgg |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32856436 |
ttgctggttagttagggtttctgctttgagtgtgaactctaacagatctctgtgcatctaagttcttcatgttgg |
32856362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 97 - 154
Target Start/End: Complemental strand, 32853391 - 32853334
Alignment:
| Q |
97 |
gccatctctttcagtgaattgctggttagttagggtttctgctttgagtgtgaactct |
154 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
32853391 |
gccatctatttcagtgaattgttggttagttagggtttctgatttgagcgtgaactct |
32853334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University