View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2977_low_11 (Length: 299)

Name: NF2977_low_11
Description: NF2977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2977_low_11
NF2977_low_11
[»] chr4 (2 HSPs)
chr4 (1-185)||(83476-83660)
chr4 (248-283)||(83724-83759)


Alignment Details
Target: chr4 (Bit Score: 181; Significance: 8e-98; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 83476 - 83660
Alignment:
1 cctatcaagcatgggcacttctcttttttgaataaacatgtttggaacttgtatgacgtgtcaaacactcttaaccgggtgtccagttaaaatattgttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
83476 cctatcaagcatgggcacttctcttttttgaataaacatgtttggaacttgtatgacgtgtcaaacactcttaaccgggtgtccagttaaaatattgttt 83575  T
101 ctaatcagcttggccatgcaccaaatacagccgagacacaaacacatcttagacacacagcctcaacaatagcttaacacctaac 185  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
83576 ctaatcagcttggccatgcaacaaatacagccgagacacaaacacatcttagacacacagcctcaacaatagcttaacacctaac 83660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 248 - 283
Target Start/End: Original strand, 83724 - 83759
Alignment:
248 gattgtaaacatagttaacatttcaaggatgatatt 283  Q
    |||||| |||||||||||||||||||||||||||||    
83724 gattgtgaacatagttaacatttcaaggatgatatt 83759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University