View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2977_low_11 (Length: 299)
Name: NF2977_low_11
Description: NF2977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2977_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 8e-98; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 83476 - 83660
Alignment:
| Q |
1 |
cctatcaagcatgggcacttctcttttttgaataaacatgtttggaacttgtatgacgtgtcaaacactcttaaccgggtgtccagttaaaatattgttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
83476 |
cctatcaagcatgggcacttctcttttttgaataaacatgtttggaacttgtatgacgtgtcaaacactcttaaccgggtgtccagttaaaatattgttt |
83575 |
T |
 |
| Q |
101 |
ctaatcagcttggccatgcaccaaatacagccgagacacaaacacatcttagacacacagcctcaacaatagcttaacacctaac |
185 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
83576 |
ctaatcagcttggccatgcaacaaatacagccgagacacaaacacatcttagacacacagcctcaacaatagcttaacacctaac |
83660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 248 - 283
Target Start/End: Original strand, 83724 - 83759
Alignment:
| Q |
248 |
gattgtaaacatagttaacatttcaaggatgatatt |
283 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
83724 |
gattgtgaacatagttaacatttcaaggatgatatt |
83759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University