View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2977_low_21 (Length: 243)

Name: NF2977_low_21
Description: NF2977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2977_low_21
NF2977_low_21
[»] chr3 (1 HSPs)
chr3 (5-225)||(31858091-31858330)


Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 5 - 225
Target Start/End: Original strand, 31858091 - 31858330
Alignment:
5 gtgcatgtgagatattattcataggatgttatggcttcaactattatttttgctgcttctgtactcttggtattcatataacctgtaggtgaagtatctt 104  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
31858091 gtgcatgtgagatattattcattggatgttatggcttcaactattatttttgctgcttccgtactcttggtattcatataacctgtaggtgaagtatctt 31858190  T
105 atat-------------------tggtctcaaaatcataactagggcactgttctgattgaacgtcaaaattatgcaaagaaaggagtatttcaaaatga 185  Q
    ||||                   |||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
31858191 atatctaacattgtctctgaacctggtctcaaaatcacaactagggcactgttctgattgaacgtcaaagttatgcaaagaaaggagtatttcaaaatga 31858290  T
186 tggttgatcgaggtaagaaaaaccgatggtggtgtgtact 225  Q
    ||||||||||||||||||||||||||||||||||||||||    
31858291 tggttgatcgaggtaagaaaaaccgatggtggtgtgtact 31858330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University