View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2979_low_8 (Length: 298)
Name: NF2979_low_8
Description: NF2979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2979_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 18 - 287
Target Start/End: Complemental strand, 3958082 - 3957813
Alignment:
| Q |
18 |
tcttcactgcgggcttttttatgacagtgactaggatgacgaacatgtacatcatttatttgattttagaatgttctcaacatctatttgatatgagatg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3958082 |
tcttcactgcgggcttttttatgacagtgactaggatgacgaatatgtacatcatttatttgattttagaatgttctcaacatctatttgatatgagatg |
3957983 |
T |
|
| Q |
118 |
ttcaggtggtctgagcttgttactattattttgggaatctatctatgttctttcattcgtttgtttcatttggtgtacgaatcgaatagggaagatgagg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3957982 |
ttcaggtggtctgagcttgttactattattttgggaatctatctatgttctttcattcgtttgtttcatttggtgtacgaatcgaatagggaagatgagg |
3957883 |
T |
|
| Q |
218 |
ttgttggtgatttgacatgttgttttgtgggcaatatggaggttgaggaatgatgtatcatttctatttt |
287 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3957882 |
ttgttggtgatctgacatgttgttttgtgggcaatatggaggttgaggaatgatgtatcatttctatttt |
3957813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University