View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2980_high_7 (Length: 356)
Name: NF2980_high_7
Description: NF2980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2980_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 29 - 342
Target Start/End: Complemental strand, 32389454 - 32389142
Alignment:
| Q |
29 |
tcccttcctctacatgcactagtgtaggacaatcattgttatgcaatgcttaaggttctttccaagtagtctttaagtgtgatgggtcaatcggcgaggg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32389454 |
tcccttcctctacatgcactagtgtaggacaatcattgttatgcaatgcttaaggttctttccaagtagtctttaagtgtgatgggtcaatcggcgaggg |
32389355 |
T |
|
| Q |
129 |
gtgacagagggatatgttactcgatagttcgtccttgtgttggaacaggttcctcttatacccttctttaccatcattatgggttttgttagcattgcta |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32389354 |
gtgacagagggatatgttactcgatagttcgtccttgtgttgtaacaggttt-tcttatacccttctttaccatcattatgggttttgttagcattgcta |
32389256 |
T |
|
| Q |
229 |
aaattctaaaggactttatgcttttgacttgctttgattgagttatttttcttgtcagtgtctcccttgggttttgctgtagttgttaggattttgtcct |
328 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32389255 |
aaattctgaaggactttatgcttttgacctgctttgattgagttatttttcttgtcagtgtctcccttgggttttgctgtagttgttaggattttgtcct |
32389156 |
T |
|
| Q |
329 |
cctttttattgaga |
342 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32389155 |
cctttttattgaga |
32389142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University