View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2980_low_16 (Length: 250)
Name: NF2980_low_16
Description: NF2980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2980_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 27 - 230
Target Start/End: Original strand, 40241880 - 40242082
Alignment:
| Q |
27 |
ttttcttatctcaaatataatgtatactatactttnnnnnnnn--tcgttataattttaattgatctgatttccttttgtaaataaaagcccctaagcct |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40241880 |
ttttcttatctcaaatataatgtatactatacttaaaaaaaaaaatcgttataattt-aattgatctgatttctttttgtaaataaaagcccctaagcct |
40241978 |
T |
 |
| Q |
125 |
taaaaagagaaattacaaagaaaatatttgcctaaaatcatgaacaaaacatctagtgcctcatgaaaaggattatcaatgactttccatatttgtaggg |
224 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40241979 |
aaaaaagagaagttacaaagaaaatatttgcctaaaatcatgaacaaaac--ctagtgcctcatgaaaaggattatcaatgacttcccatatttgtaggg |
40242076 |
T |
 |
| Q |
225 |
atatcg |
230 |
Q |
| |
|
|||||| |
|
|
| T |
40242077 |
atatcg |
40242082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University