View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2980_low_17 (Length: 250)
Name: NF2980_low_17
Description: NF2980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2980_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 22 - 247
Target Start/End: Original strand, 41861869 - 41862097
Alignment:
| Q |
22 |
gttagctaaatgaaaattttcaaatattgaaagtggatgattcaannnnnnnnnn---aagaaaaaatgatgattcttaagaagggatttcttaattatt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41861869 |
gttagctaaatgaaaattttcaaatattgaaagtggatgattcaaagaaaaaaaatttaagaaaaaatgatgattcttaagaagggatttcttaattatt |
41861968 |
T |
 |
| Q |
119 |
aggtgaggtagctatatacaagttcttagtnnnnnnnnnnnnnnnnntcttaaggagtgatttattatgcgtactcataagttcataaccaatcaaagag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41861969 |
aggtgaggtagctatatacaagttcttagtaaaaaaaattaaaaaaatcttaaggagtgatttattatgcgtactcataagttcataaccaatcaaagag |
41862068 |
T |
 |
| Q |
219 |
ttactcttttagagtaggcattttggatg |
247 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41862069 |
ttactcttttagagtaggcattttggatg |
41862097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University