View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2980_low_24 (Length: 208)

Name: NF2980_low_24
Description: NF2980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2980_low_24
NF2980_low_24
[»] scaffold0194 (1 HSPs)
scaffold0194 (21-191)||(25807-25977)


Alignment Details
Target: scaffold0194 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: scaffold0194
Description:

Target: scaffold0194; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 21 - 191
Target Start/End: Original strand, 25807 - 25977
Alignment:
21 aacaacggaatggtggataattacatgcctcagacacaaacttcaggaggattttatggtgcaaattcttttgataaaatgagttttgcagatgtgatgc 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25807 aacaacggaatggtggataattacatgcctcagacacaaacttcaggaggattttatggtgcaaattcttttgataaaatgagttttgcagatgtgatgc 25906  T
121 agtttgcagattttggacctaaattagccttaaaccgcgaagaatcaggtatcgaagacccggtttatttt 191  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25907 agtttgcagattttggacctaaattagccttaaaccgcgaagaatcaggtatcgaagacccggtttatttt 25977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University