View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2980_low_24 (Length: 208)
Name: NF2980_low_24
Description: NF2980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2980_low_24 |
 | |
|
| [»] scaffold0194 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0194 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 21 - 191
Target Start/End: Original strand, 25807 - 25977
Alignment:
| Q |
21 |
aacaacggaatggtggataattacatgcctcagacacaaacttcaggaggattttatggtgcaaattcttttgataaaatgagttttgcagatgtgatgc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25807 |
aacaacggaatggtggataattacatgcctcagacacaaacttcaggaggattttatggtgcaaattcttttgataaaatgagttttgcagatgtgatgc |
25906 |
T |
|
| Q |
121 |
agtttgcagattttggacctaaattagccttaaaccgcgaagaatcaggtatcgaagacccggtttatttt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25907 |
agtttgcagattttggacctaaattagccttaaaccgcgaagaatcaggtatcgaagacccggtttatttt |
25977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University