View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2981_high_8 (Length: 237)
Name: NF2981_high_8
Description: NF2981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2981_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 16 - 212
Target Start/End: Complemental strand, 21801923 - 21801726
Alignment:
| Q |
16 |
aagaatgataattcatgtgtgtataataataatcattaactttttcatgaatgattattatannnnnnn-attacatattcaaactagtaattccctata |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
21801923 |
aagaatgataattcatgtgtgtataataataatcattaactttttcatgaatgattattatattttttttattacatattcaaactagtaatgccctata |
21801824 |
T |
 |
| Q |
115 |
gataagttggaaatcagtggatatttaacttttatcttattaatcataaactggccctataaaaagttaaaatattgatagtatatcatttcttttaa |
212 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21801823 |
gataagttggaaatcggtggatatttaacttttatcttagtaatcataaactggccctataaaaagttaaaatattgatagtatatcatttcttttaa |
21801726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University