View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2981_low_14 (Length: 237)

Name: NF2981_low_14
Description: NF2981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2981_low_14
NF2981_low_14
[»] chr3 (1 HSPs)
chr3 (16-212)||(21801726-21801923)


Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 16 - 212
Target Start/End: Complemental strand, 21801923 - 21801726
Alignment:
16 aagaatgataattcatgtgtgtataataataatcattaactttttcatgaatgattattatannnnnnn-attacatattcaaactagtaattccctata 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||| |||||||    
21801923 aagaatgataattcatgtgtgtataataataatcattaactttttcatgaatgattattatattttttttattacatattcaaactagtaatgccctata 21801824  T
115 gataagttggaaatcagtggatatttaacttttatcttattaatcataaactggccctataaaaagttaaaatattgatagtatatcatttcttttaa 212  Q
    ||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21801823 gataagttggaaatcggtggatatttaacttttatcttagtaatcataaactggccctataaaaagttaaaatattgatagtatatcatttcttttaa 21801726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University