View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2983_high_10 (Length: 204)
Name: NF2983_high_10
Description: NF2983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2983_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 16 - 187
Target Start/End: Original strand, 41550206 - 41550377
Alignment:
| Q |
16 |
agatgaattgcaccgagccaatatgacaatatcagtggtcatggtggtaggggggactggaacacaacagtgatcatcactcattctcagtactataggt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41550206 |
agatgaattgcaccgagccaatatgacaatatcagtggtcatggtggtaggggggactggaacacaacagtgatcatcactcattctcagtactataggt |
41550305 |
T |
|
| Q |
116 |
cacggcagtataggaccacatggagttcaggactacttgaagtcattaacctatattgtcgttgtaataatt |
187 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41550306 |
cacggcagtgtaggaccacatggagttcaggactacttgaagtcattaacctatattgtcgttgtaataatt |
41550377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University