View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2983_low_12 (Length: 252)
Name: NF2983_low_12
Description: NF2983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2983_low_12 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 11 - 252
Target Start/End: Complemental strand, 49634087 - 49633855
Alignment:
| Q |
11 |
cacagattaaagacacaaaatcctcaccaaccacaccaatcaaaccctatcttattattactattattacctatacatatatcacaccaaaatctacgac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49634087 |
cacagattaaagacacaaaatcctcaccaa---------tcaaaccctatcttattattactattattacctatacatatatcacaccaaaatctacgac |
49633997 |
T |
 |
| Q |
111 |
gtgtccctaacatggaaatagttcttgttcttgacgacaatgtcatacatgtgcatgggcttgagcttgttgaagtcctttggaagagaaatgaggtaca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49633996 |
gtgtccctaacatggaaatagttcttgttcttgacgacaatgtcatacatgtgcatgggcttgagcttgttgaagtcctttggaagagaaatgaggtaca |
49633897 |
T |
 |
| Q |
211 |
cggtggaacgtttatggaactgaagcagatgatcagggtcat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49633896 |
cggtggaacgtttatggaactgaagcagatgatcagggtcat |
49633855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 130 - 184
Target Start/End: Original strand, 14418665 - 14418719
Alignment:
| Q |
130 |
agttcttgttcttgacgacaatgtcatacatgtgcatgggcttgagcttgttgaa |
184 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||| ||||| | ||||||| |
|
|
| T |
14418665 |
agttcttgttcttgacaacgatgtcatacatgtgcatggacttgaacctgttgaa |
14418719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University