View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2984_high_21 (Length: 263)
Name: NF2984_high_21
Description: NF2984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2984_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 8 - 138
Target Start/End: Original strand, 8528525 - 8528655
Alignment:
| Q |
8 |
gaggagcagagagatgagatcacttctataatgggtgttcaagctgttttgggcacaagtaaataccttggccacccgtcaatggtgggaagagatcgaa |
107 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8528525 |
gaggatcagagagatgagatcacttctataatgggtgttcaagctgttttgggtacaagtaaataccttggcctcccgtcaatggtgggaagagatcgaa |
8528624 |
T |
 |
| Q |
108 |
atgctattttctcttatatcaaagaccgtgt |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8528625 |
atgctattttctcttatatcaaagaccgtgt |
8528655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 133 - 263
Target Start/End: Original strand, 8528724 - 8528854
Alignment:
| Q |
133 |
ccgtgttgcaagctattccatcgtacgtaatgagtatttttctgttgccaacatccttaatatctaccatagagaagatgatgaattcggtcttgtgggg |
232 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| |||||| |
|
|
| T |
8528724 |
ccgtgttgcaagctattccctcgtacgtaatgagtatttttctgttgccaacatccttaatatctactatagagaagatgatgaattcgttctagtgggg |
8528823 |
T |
 |
| Q |
233 |
gactggtggtgccgcgaatagaggcattcat |
263 |
Q |
| |
|
||| ||||||||||||||||||||||||||| |
|
|
| T |
8528824 |
gaccggtggtgccgcgaatagaggcattcat |
8528854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 15 - 129
Target Start/End: Complemental strand, 5603018 - 5602908
Alignment:
| Q |
15 |
agagagatgagatcacttctataatgggtgttcaagctgttttgggcacaagtaaataccttggccacccgtcaatggtgggaagagatcgaaatgctat |
114 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||||||||||||||||| |
|
|
| T |
5603018 |
agagagatgggatcacttctataatgggtgttcaagctgttttgggcacaagtaaataccttgacctcccg----tggtgggaagagatcgaaatgctat |
5602923 |
T |
 |
| Q |
115 |
tttctcttatatcaa |
129 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5602922 |
tttctcttatatcaa |
5602908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 32 - 136
Target Start/End: Original strand, 19312556 - 19312660
Alignment:
| Q |
32 |
tctataatgggtgttcaagctgttttgggcacaagtaaataccttggccacccgtcaatggtgggaagagatcgaaatgctattttctcttatatcaaag |
131 |
Q |
| |
|
||||| |||||||||||||| || ||||||||| ||||||| ||||||| ||| |||||||||||||||||||| ||| || | || ||||||||||||| |
|
|
| T |
19312556 |
tctattatgggtgttcaagccgtgttgggcacatgtaaatatcttggcctcccttcaatggtgggaagagatcgtaattctgtcttttcttatatcaaag |
19312655 |
T |
 |
| Q |
132 |
accgt |
136 |
Q |
| |
|
||||| |
|
|
| T |
19312656 |
accgt |
19312660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University