View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2984_high_31 (Length: 237)
Name: NF2984_high_31
Description: NF2984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2984_high_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 163
Target Start/End: Complemental strand, 46745196 - 46745031
Alignment:
| Q |
1 |
atgtataaagagaaattttttaaaattttactttaagaatttcaatattaataatcttggagcttttgtccttgctaaatgtttgtgaactttcctgcct |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
46745196 |
atgtataaagagaatttttttaaaattttactttaagaatttcactattaataatcttggagcttttgtccttgctaaatgtttgtgaactttcctgtct |
46745097 |
T |
|
| Q |
101 |
---gtgtcggaaggataagctaaagtacaatctaatagagtagttttatctcttccattccctgga |
163 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46745096 |
gtggtgttggaaggataagctaaagtacaatctaatagagtagttttatctcttccattccctgga |
46745031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 222
Target Start/End: Complemental strand, 46745003 - 46744957
Alignment:
| Q |
176 |
tgtatatagtgattcttgattaataacgaaattcctagactgttttt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46745003 |
tgtatatagtgattcttgattaataacgaaattcctagactattttt |
46744957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University