View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2984_high_36 (Length: 216)
Name: NF2984_high_36
Description: NF2984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2984_high_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 96 - 201
Target Start/End: Original strand, 45122166 - 45122271
Alignment:
| Q |
96 |
atacatattttttactcggtaataaaatctctacactaacattctttttgagcaatattcaagtgcccgagtgttgatattataaatcaatactaagttc |
195 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
45122166 |
atacatattttttactcagtaataaaatctctacactaacattctttttgagcaatattcaagtggccgagtgttgatattataaatcaatgctaagttc |
45122265 |
T |
 |
| Q |
196 |
atctca |
201 |
Q |
| |
|
||||| |
|
|
| T |
45122266 |
ttctca |
45122271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 53 - 110
Target Start/End: Original strand, 45122028 - 45122085
Alignment:
| Q |
53 |
ttataaaaaatatagtataaatagtttttgcatcagacactgaatacatattttttac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45122028 |
ttataaaaaatatagtataaatagtttttgcatcagacactgaatacatattttttac |
45122085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 18 - 58
Target Start/End: Original strand, 45121959 - 45121999
Alignment:
| Q |
18 |
tatataagaatgatcaagggtaaaaaatgttgggcttataa |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45121959 |
tatataagaatgatcaagggtaaaaaatgttgggcttataa |
45121999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University