View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2984_low_18 (Length: 338)
Name: NF2984_low_18
Description: NF2984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2984_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 21 - 326
Target Start/End: Original strand, 44493728 - 44494033
Alignment:
| Q |
21 |
atcttacctcaaaaacagtccctcaaattatttgctctgtcctcaacaacaccataaaagaggttaagcaatcatcttccaattgcaccggactccgaat |
120 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44493728 |
atcttacctcaaaaacagtcccgcaaattatttgctctgtcctcaacaacaccataaaagaggttaagcaatcatcttccaattgcaccggactccgaat |
44493827 |
T |
 |
| Q |
121 |
tcgcggtcgaagtgcacaaagcatacttgaccaaagagcacttgaggattgtgtcaatttatttgacactaccattgacgaactcaaaacaaccatttct |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44493828 |
tcgcggtcgaagtgcacaaagcatacttgaccaaagagcgcttgaggattgtgtcaatttatttgacactaccattgacgaactcaaaacaaccatttct |
44493927 |
T |
 |
| Q |
221 |
gatctctctcaaactcaaaccacaatagcttatagcagtaagcgtgactgtcaaactctacttagtggtgcaatgaccaatgtgtacacatgtttggatg |
320 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44493928 |
gatctctctcaaactcaaaccacagtagcttctagcagtaagcgtgactgtcaaactctacttagtggtgcaatgaccaatgtgtacacatgtttggatg |
44494027 |
T |
 |
| Q |
321 |
gttttg |
326 |
Q |
| |
|
|||||| |
|
|
| T |
44494028 |
gttttg |
44494033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University