View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2984_low_29 (Length: 258)

Name: NF2984_low_29
Description: NF2984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2984_low_29
NF2984_low_29
[»] chr5 (1 HSPs)
chr5 (107-249)||(29306496-29306635)


Alignment Details
Target: chr5 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 107 - 249
Target Start/End: Original strand, 29306496 - 29306635
Alignment:
107 taaaaaatttagagttcttcacattagtattccagccggcgtaaatgtggctcatcggccatatttgtctgcattttgccgcaatataaaggcttacaac 206  Q
    ||||||||||||||||||||||||||||||| ||||||   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29306496 taaaaaatttagagttcttcacattagtattgcagccg---taaatgtggctcatcggccatatttgtctgcattttgccgcaatataaaggcttacaac 29306592  T
207 gcaactgcgatcacagttgctgttttgatctctgaatctctgc 249  Q
    |||||||||||||||||||||||||||||||| ||||||||||    
29306593 gcaactgcgatcacagttgctgttttgatctcagaatctctgc 29306635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University