View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2984_low_34 (Length: 243)
Name: NF2984_low_34
Description: NF2984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2984_low_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 3e-84; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 15 - 218
Target Start/End: Complemental strand, 31544230 - 31544021
Alignment:
| Q |
15 |
aatatacaaaatttagtacactgttagtgaccaaataagcatgaaaacattgccccaacaatcagttttgtactatttttccatcctcatcattgtca-- |
112 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
31544230 |
aatatacaaaatttagtgcactgttagtgactaaataagcatgaaaacattgccccaacaatcagttttgtactatttttccatcctcatcattgtaacg |
31544131 |
T |
|
| Q |
113 |
-ttcc---aacttatggagagaaagatgcagattacatgtcccaacttatgaaagcactgaccccaactcccaaaggctggtctagcaacattcactact |
208 |
Q |
| |
|
|| | |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31544130 |
gttactataactaatggagagaaagatgcagattacatgtcccaacttatgaaagcactgaccccaactcccaaaggctggtctggcaacattcactact |
31544031 |
T |
|
| Q |
209 |
gcaaatggaa |
218 |
Q |
| |
|
|||||||||| |
|
|
| T |
31544030 |
gcaaatggaa |
31544021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 140 - 222
Target Start/End: Complemental strand, 31535449 - 31535367
Alignment:
| Q |
140 |
attacatgtcccaacttatgaaagcactgaccccaactcccaaaggctggtctagcaacattcactactgcaaatggaacggc |
222 |
Q |
| |
|
||||||||||| ||||| |||||||||| |||||||||||| |||||||| ||||| ||||||||||| |||||||||| |
|
|
| T |
31535449 |
attacatgtccaaacttttgaaagcactaaccccaactccctctaactggtctaacaacactcactactgcagatggaacggc |
31535367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 140 - 217
Target Start/End: Original strand, 31550579 - 31550656
Alignment:
| Q |
140 |
attacatgtcccaacttatgaaagcactgaccccaactcccaaaggctggtctagcaacattcactactgcaaatgga |
217 |
Q |
| |
|
|||| |||||||||||| |||||||| ||||||||||||| |||||||||| ||||| ||| ||||||| |||| |
|
|
| T |
31550579 |
attatatgtcccaacttttgaaagcattgaccccaactccttctggctggtctaacaacactcatcactgcaattgga |
31550656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University