View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2984_low_39 (Length: 236)
Name: NF2984_low_39
Description: NF2984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2984_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 75 - 221
Target Start/End: Complemental strand, 22829045 - 22828899
Alignment:
| Q |
75 |
aacattgagccttaatgcaagcctaatccttctattttcttccctctctctgtcgagttcccaccttcctcccttctttgataatttgaagaatttataa |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
22829045 |
aacattgagccttaatgcaagcctaatccttctattttcttccctctctctgtcgagttcccaccttcctcccttctttgataatttgaagaattgaaaa |
22828946 |
T |
 |
| Q |
175 |
gcaagaatcattgcatgtttgattagagtggtcattaagggttaatg |
221 |
Q |
| |
|
|||| | |||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
22828945 |
gcaactaccattgcatgtttgattagagtgatgattaagggttaatg |
22828899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University