View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2985_low_5 (Length: 351)
Name: NF2985_low_5
Description: NF2985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2985_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-109; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 18 - 222
Target Start/End: Original strand, 32515725 - 32515929
Alignment:
| Q |
18 |
agtgatgaagaagtttttactgattacatggacacattttataacagctcctcctggcatggagatcgttgatttcttgccaactccttcggttttgccg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32515725 |
agtgatgaagaagtttttactgattacatggacacattttataacagctcctcctggcatggagatcgttgatttcttgccaactccttcggttttgccg |
32515824 |
T |
|
| Q |
118 |
tcgtggataactgaggaagaactcatggtttttgcagacaaattccaagagtctggtttcactggtgcattcaattactaccgcacaatggacctgtaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32515825 |
tcgtggataactgaggaagaactcatggtttttgcagacaaattccaagagtctggtttcactggtgcattcaattactaccgcgcaatggacctgtaag |
32515924 |
T |
|
| Q |
218 |
tacca |
222 |
Q |
| |
|
||||| |
|
|
| T |
32515925 |
tacca |
32515929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 252 - 345
Target Start/End: Original strand, 32515959 - 32516052
Alignment:
| Q |
252 |
atacaacaatccatttattcacactccatggttacagaagctgggagcttctagcaccatggcaaggatcaaagataacagttccaactaagtt |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32515959 |
atacaacaatccatttattcacactccatggttacagaagctgggagcttctagcaccatggcaaggatcaaagataacagttccaactaagtt |
32516052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University