View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2985_low_7 (Length: 273)
Name: NF2985_low_7
Description: NF2985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2985_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 44960733 - 44960985
Alignment:
| Q |
1 |
atgacggtctttggtggaagttcttttcggaggaggttttttgttggcagggtcagaggttgttggtgttgatgctgggactagttggttggatcggttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44960733 |
atgacggtctttggtggaagttcttttcggaggaggttttttgttggcagggtcagaggttgttggtgttgatgctgggactagttggttggatcggttt |
44960832 |
T |
|
| Q |
101 |
gaatttgatgtacttggttctgttggtgagattgctagggatggatatggagaagaagttgaacatgatgctgcttcttggttatcttctttcttctcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44960833 |
gaatttgatgtacttggttctgttggtgagattgctagggatggatatggagaagaagttgaacatgatgctgcttcttggttatcttctttcttctcaa |
44960932 |
T |
|
| Q |
201 |
gaagttgaaatggaaaattttgtctttgttgttgttggtgttggtggtggtgt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44960933 |
gaagttgaaatggaaaattttgtctttgttgttgttggtgttggtggtggtgt |
44960985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University