View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2986-Insertion-15 (Length: 319)
Name: NF2986-Insertion-15
Description: NF2986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2986-Insertion-15 |
![](./plan/images/spacer.gif) | ![NF2986-Insertion-15](./plan/images/spacer.gif) |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 4e-66; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 157 - 316
Target Start/End: Complemental strand, 27914817 - 27914658
Alignment:
Q |
157 |
aaacacactttcattgtctgtttattgagtaggggtcggaggacaagaacatacgtattacgtacttaaataattaatacattggtcatggatacttgca |
256 |
Q |
|
|
||||||||||| |||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
27914817 |
aaacacacttttattgtctgtttagagagtaggggtctgaggacaagaacatacgtattacgtacttaaataattaatacattggtcatggaaacttgca |
27914718 |
T |
![](./plan/images/spacer.gif) |
Q |
257 |
tgaaagagtacttgattggccacttgcagatatatatactagattcttcgcacgatccag |
316 |
Q |
|
|
|||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27914717 |
agaaagagtacgtgattggctacttgcagatatatatactagattcttcgcacgatccag |
27914658 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 8 - 142
Target Start/End: Complemental strand, 27915205 - 27915071
Alignment:
Q |
8 |
aatattgtaagatcgagaaaaatggcaaccagaaggaaaataatgattgataaattatgagtgaatagaaatgtatgtcaactccagcccctatatagct |
107 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| | |
|
|
T |
27915205 |
aatattgtaagatcgaggaaaatggcaaccagaaggaaaataatgattgataaattatgagtgaatagaaatgtatgtcaattccggcccctatatagtt |
27915106 |
T |
![](./plan/images/spacer.gif) |
Q |
108 |
aaccattttattgaattatacagtatatgttacta |
142 |
Q |
|
|
|||| ||||||||||||||| | |||||||||||| |
|
|
T |
27915105 |
aaccgttttattgaattataaaatatatgttacta |
27915071 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 9 - 144
Target Start/End: Complemental strand, 27909816 - 27909681
Alignment:
Q |
9 |
atattgtaagatcgagaaaaatggcaaccagaaggaaaataatgattgataaattatgagtgaatagaaatgtatgtcaactccagcccctatatagcta |
108 |
Q |
|
|
||||||||||||| || |||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| || |
|
|
T |
27909816 |
atattgtaagatcaaggaaaatggcaatcagaagggatataatgattgataaattatgagtgaatagaaatgtatgtcaattccggcccctatatagtta |
27909717 |
T |
![](./plan/images/spacer.gif) |
Q |
109 |
accattttattgaattatacagtatatgttactagt |
144 |
Q |
|
|
||||||||||||||||||| | |||||||||||||| |
|
|
T |
27909716 |
accattttattgaattataaaatatatgttactagt |
27909681 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 31559 times since January 2019
Visitors: 1222