View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2986-Insertion-18 (Length: 223)
Name: NF2986-Insertion-18
Description: NF2986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2986-Insertion-18 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 8 - 223
Target Start/End: Original strand, 14987888 - 14988103
Alignment:
| Q |
8 |
cttctaagtgttcttcatttgatcttgaatgttatgtaatgatactagaattgtaaaggaaaattagaatgattttgatattagtgacagaagaaaaagc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14987888 |
cttctaagtgttcttcatttgatcttgagtgttatgtaatgataatagaattgtaaaggaaaattagaatgattttgatattagtgaccgaagaaaaagc |
14987987 |
T |
|
| Q |
108 |
caaatataaaatctttctttttggcccctacaaatctagactccagacggttgcatccgaagcctaaccccaaagccgaccctgcttatgaccgaataat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
14987988 |
caaatataaaatctttctttttggcccctacaaatttagactctagacggttgcatccgaagcctaaccccagagccgaccctgcttatgaccgaataat |
14988087 |
T |
|
| Q |
208 |
cgttatcaaagcacta |
223 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
14988088 |
cgttatcaaagcacta |
14988103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 42 - 89
Target Start/End: Complemental strand, 17952098 - 17952051
Alignment:
| Q |
42 |
tgtaatgatactagaattgtaaaggaaaattagaatgattttgatatt |
89 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
17952098 |
tgtaatgatactagaattgtaaaggacaattagaatggttttgatatt |
17952051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 44 - 89
Target Start/End: Complemental strand, 29753694 - 29753648
Alignment:
| Q |
44 |
taatgatactagaattgtaaaggaaaatt-agaatgattttgatatt |
89 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
29753694 |
taatgatactagaattgtaaaggaaaattaagaatgagtttgatatt |
29753648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 44562118 - 44562074
Alignment:
| Q |
41 |
atgtaatgatactagaattgtaaaggaaaattagaatgattttga |
85 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| ||||| |||||| |
|
|
| T |
44562118 |
atgtaatgatactagaatcgcaaaggaaaattggaatggttttga |
44562074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University