View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2986R-Insertion-11 (Length: 61)
Name: NF2986R-Insertion-11
Description: NF2986R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2986R-Insertion-11 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 49; Significance: 7e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 7e-20
Query Start/End: Original strand, 9 - 61
Target Start/End: Original strand, 37185121 - 37185173
Alignment:
| Q |
9 |
gttattgttggttgttgactcagaatgggaagggtttccatcctcgtccatgt |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37185121 |
gttattgttggttgttgactcagaatgggaagggttgccatcctcgtccatgt |
37185173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University