View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2986R-Insertion-7 (Length: 272)
Name: NF2986R-Insertion-7
Description: NF2986R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2986R-Insertion-7 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 9 - 272
Target Start/End: Original strand, 45014967 - 45015230
Alignment:
| Q |
9 |
tgtattacacgtattaattaaaacaaaaggnnnnnnnnnnngcaataatcgtagaaaggtgtgagagtgagtgcacttaactaccttgatcttgctgtgg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45014967 |
tgtattacacgtattaattaaaacaaaaggaaaaaaaaaaaagaataatcgtagaaaggtgtgagagtgagtgcacttaactaccttgatcttgctgtgg |
45015066 |
T |
|
| Q |
109 |
tggctgagattgttcaatattatggattgatgaagcttcatgcatttcattgttattgttgccgcccatgacttgtgtaagagcagatactatggcagac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45015067 |
tggctgagattgttcaatattatggattgatgaagcttcatgcatttcattgttattgttgccgcccatgacttgtgtaagagcagatactatggcagac |
45015166 |
T |
|
| Q |
209 |
atatcttgttgggacctttcagaaaacactggaaacaaattctcatcttcttttccctcttctt |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45015167 |
atatcttgttgggacctttcagaaaacactggaaacaaattctcatcttcttttccctcttctt |
45015230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University