View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2986R-Insertion-9 (Length: 132)
Name: NF2986R-Insertion-9
Description: NF2986R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2986R-Insertion-9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 5e-60; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 5e-60
Query Start/End: Original strand, 9 - 125
Target Start/End: Original strand, 37917864 - 37917980
Alignment:
| Q |
9 |
cttttgaggttgttgagattctttctaggtctggaagtagtgtgcggtgaaatctgtttggtagatctttgaactctgaaagtgaaacaaaatcatcatc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37917864 |
cttttgaggttgttgagattctttctaggtctggaagtagtgtgcggtgaaatctgtttggtagatctttgaactctgaaagtgaaacaaaatcatcatc |
37917963 |
T |
 |
| Q |
109 |
ttcatcttcttcttgtt |
125 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
37917964 |
ttcatcttcttcttgtt |
37917980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University