View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2986_high_13 (Length: 220)

Name: NF2986_high_13
Description: NF2986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2986_high_13
NF2986_high_13
[»] chr7 (1 HSPs)
chr7 (1-189)||(22048883-22049071)


Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 22048883 - 22049071
Alignment:
1 gcattcacgtggtcggaatatcaatgatcgtttaatcaaattgttttgtgaaaacatggagaatgttaaaatttgttttgattatgtttaaaatatatta 100  Q
    ||||||||||||||| ||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
22048883 gcattcacgtggtcgaaatatcagtgaacgtttaatcaaattgttttgtgaaaacatggagaatgttaaaaattgttttgattatgtttaaaatatatta 22048982  T
101 tctctaaccagtgtttcatctcctctccaatataaaacttcacttcaaaaatcttacttcatatttgcaagttaaaatgaacacatttt 189  Q
    |||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||    
22048983 tctctaactagtgtttcatctcctctccaatataacacttcacttcaaaaatcttacttcatattagcaagttaaaatgaacacatttt 22049071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University