View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2986_low_12 (Length: 252)
Name: NF2986_low_12
Description: NF2986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2986_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 8358370 - 8358588
Alignment:
| Q |
1 |
acttgaagaacatgtttacttgtgctttctcaccgttaacaaatctaggagacttgttctgcaacaaattacagagagatcacaacattaatta-----t |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
8358370 |
acttgaagaacatgtttacttgtgctttctcaccgttaacaaatctaggagacttgttctgcaacaaattacagagagatcacaacattaattatattat |
8358469 |
T |
 |
| Q |
96 |
attatattaatttagaaaagaaaatatgagagacatattttaaactcaattatattgcttacgagtaatattatagaggaaataaataattcacgggcgt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
8358470 |
attatattaatttagaaaagaaaatatgagagacatattttaaactcaattatattgcttacaagtaatattatagaggaaataaataattcacggacgt |
8358569 |
T |
 |
| Q |
196 |
gattttcacacgttgcttg |
214 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
8358570 |
gattttcacacgttgcttg |
8358588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 2 - 77
Target Start/End: Complemental strand, 28593199 - 28593124
Alignment:
| Q |
2 |
cttgaagaacatgtttacttgtgctttctcaccgttaacaaatctaggagacttgttctgcaacaaattacagaga |
77 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| | || |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28593199 |
cttgaagaacatgtttacttgtgctttcttaccatcaataaatctaggagacttgttatgcaacaaattacagaga |
28593124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University