View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2986_low_14 (Length: 225)
Name: NF2986_low_14
Description: NF2986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2986_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 174
Target Start/End: Original strand, 27915530 - 27915715
Alignment:
| Q |
1 |
tttggtatgttgaatattatattattaacaataggctcggttatgtttggttatgaagagacacacatagagagacagacataaaatctaagttatacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27915530 |
tttggtatgttgaatattatattattaacaagaggctcggttatgtttggttatgaagagacacacatagagacacagacataaaatctaagttatacaa |
27915629 |
T |
|
| Q |
101 |
gcaatttcaagtgaacctcttc------------gtaagtttgaagtatatatgcatgtatgcaatttttagaaattataattaag |
174 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27915630 |
gcaatttcaagtgaacctcttccctttataaagggtaagtttgaagtatatatgcatgtatgaaatttttagaaattataattaag |
27915715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 20 - 69
Target Start/End: Original strand, 27922265 - 27922315
Alignment:
| Q |
20 |
tattattaacaataggct-cggttatgtttggttatgaagagacacacata |
69 |
Q |
| |
|
|||||||||||||||| | ||||| |||||||||||||||||||||||||| |
|
|
| T |
27922265 |
tattattaacaataggattcggttgtgtttggttatgaagagacacacata |
27922315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 212
Target Start/End: Original strand, 27916042 - 27916070
Alignment:
| Q |
184 |
tcggaaattaaatttggcatctgttcttc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27916042 |
tcggaaattaaatttggcatctgttcttc |
27916070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University