View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2986_low_16 (Length: 219)

Name: NF2986_low_16
Description: NF2986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2986_low_16
NF2986_low_16
[»] chr6 (1 HSPs)
chr6 (124-188)||(10826323-10826387)


Alignment Details
Target: chr6 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 124 - 188
Target Start/End: Original strand, 10826323 - 10826387
Alignment:
124 gttgtggttgttcgtctgtcatctcgtctttctactccttttcttcgcgtttacatctctctatt 188  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10826323 gttgtggttgttcgtctgtcatctcgtctttctactccttttcttcgcgtttacatctctctatt 10826387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University