View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2986_low_6 (Length: 353)
Name: NF2986_low_6
Description: NF2986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2986_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 24 - 343
Target Start/End: Complemental strand, 20234206 - 20233887
Alignment:
| Q |
24 |
tataagaccacaacatcaatcataatttctttccatctgtactagacttgtgcttctactaaccaatattcttatgccaattgtcatcatgcaattggtt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
20234206 |
tataagaccacaacatcaatcataatttctttccatctgtactagacttgtgcttctactaaccaatattcttatgccaattgtcaccatgcaattggtt |
20234107 |
T |
 |
| Q |
124 |
caattaattttagccctatcacaagttcacaaccttttgctcaacaatgtcttctaaggcatgatgatgttctttttacagcaaaggatcgttttgggtt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20234106 |
caattaattttagccctatcacaagttcacaaccttttgctcaacaatgtcttttaaggcatgatgatgttctttttacagcaaaggatcgttttgggtt |
20234007 |
T |
 |
| Q |
224 |
ttactaaaggattnnnnnnnncaatgtagcttcttttaggtatcctctcatgtaacttgtgatgacaacaatgatggattgtcatttttgttacttcaag |
323 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20234006 |
ttactaaaggattaaaaaaaacaatgtagcttcttttaggtatcctctcatgtaacttgtgatgacaacaatgatggattgtcatttttgttacttcaag |
20233907 |
T |
 |
| Q |
324 |
caaaagtgtctttgtctgtg |
343 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
20233906 |
caaaagtgtctttgtctgtg |
20233887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University