View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2988_low_10 (Length: 252)
Name: NF2988_low_10
Description: NF2988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2988_low_10 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 11 - 252
Target Start/End: Original strand, 35383633 - 35383878
Alignment:
| Q |
11 |
cacagacatgtcatcacctgccacttcatcaccaatttttggtgggttatctccaggattgagctctccattcaatgacaattctagagcaccttcagag |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |
|
|
| T |
35383633 |
cacaaacatgtcatcacctgccacttcatcaccaatttttggtgggttatctccaggattgagttctccattcaatgacaattctagagcaccttcaaag |
35383732 |
T |
|
| Q |
111 |
gaactagccaaatggtttttacttttcttttcctctcttctcattctctccattatctc----ttagcatgtgtgtgatcttgagggagactaattgcag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
35383733 |
gaactagccaaatggtttttacttttcttttcttctcttctcattctctccattatctcttaattagcatgtgtgtgatcttgagggagactaattacag |
35383832 |
T |
|
| Q |
207 |
ttttgtcacaagttaaagggagctttttgttgtttataactcttat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35383833 |
ttttgtcacaagttaaagggagctttttgttgtttataactcttat |
35383878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University