View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2988_low_6 (Length: 329)
Name: NF2988_low_6
Description: NF2988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2988_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 4e-66; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 12 - 168
Target Start/End: Original strand, 4014072 - 4014228
Alignment:
| Q |
12 |
cacagacccaaatttagtattnnnnnnncaaagctattagaaatgacataccacaagatagtcttctttaacatattttcctttagatggtttgcaaagc |
111 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
4014072 |
cacagacccaaatttagtattaaaaaaacaaagctattagaaatgacataccacaagatagtcttctttaacatgttttcctttaggtggtttgcaaagc |
4014171 |
T |
|
| Q |
112 |
aactttctattgttgaagtcggtggatatggtgagaggataaggatgttgatgtgtt |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4014172 |
aactttctattgttgaagtcggtggatatggtgagaggataaggatgttgatgtgtt |
4014228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 116; Significance: 5e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 12 - 168
Target Start/End: Complemental strand, 13975124 - 13974968
Alignment:
| Q |
12 |
cacagacccaaatttagtattnnnnnnncaaagctattagaaatgacataccacaagatagtcttctttaacatattttcctttagatggtttgcaaagc |
111 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || || |||||||| ||||||||||||| |
|
|
| T |
13975124 |
cacagacccaaatttagtattaaaaaaacaaagctattagaaatgacataccacaagatagtcttctttaaaatgttatcctttaggtggtttgcaaagc |
13975025 |
T |
|
| Q |
112 |
aactttctattgttgaagtcggtggatatggtgagaggataaggatgttgatgtgtt |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13975024 |
aactttctattgttgaagtcggtggatatggtgagaggataaggatgttgatatgtt |
13974968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University