View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2990_high_8 (Length: 251)
Name: NF2990_high_8
Description: NF2990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2990_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 15 - 235
Target Start/End: Original strand, 20988198 - 20988418
Alignment:
| Q |
15 |
tgaaggaaaaagttccggagctgaagaagaaaccggagaatttcgatccgagttcggttgtttgctgggagaaaaacaaacctgtgccgtttttgtttct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20988198 |
tgaaggaaaaagttccggagctgaagaagaaaccggagaatttcgatccgagttcggttgtttgctgggagaaaaacaaacctgtgccgtttttgtttct |
20988297 |
T |
|
| Q |
115 |
ctctttagcgttcgatttgattagcaaagagaggggaagaattgtgatcactgagattgtgtgtaatctgttgaggactgtgatacatgccacacctgat |
214 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20988298 |
ctctttagcgtttgatttgattagcaaagagaggggaagaattgtgatcactgagattgtgtgtaatctgttgaggactgtgatacatgccacacctgat |
20988397 |
T |
|
| Q |
215 |
gatcttgttccggttgtttat |
235 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
20988398 |
gatcttgttccggttgtttat |
20988418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 15 - 235
Target Start/End: Original strand, 20998430 - 20998650
Alignment:
| Q |
15 |
tgaaggaaaaagttccggagctgaagaagaaaccggagaatttcgatccgagttcggttgtttgctgggagaaaaacaaacctgtgccgtttttgtttct |
114 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||| || |||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
20998430 |
tgaaggaaaaggttccgcagctgaagaagaaaccggcgagtttcgatccgagttcggttgtttgctgggagaaagacaaacctgttccgtttttgtttct |
20998529 |
T |
|
| Q |
115 |
ctctttagcgttcgatttgattagcaaagagaggggaagaattgtgatcactgagattgtgtgtaatctgttgaggactgtgatacatgccacacctgat |
214 |
Q |
| |
|
|| ||| ||||| ||| |||||| | ||||||| || || |||||||||||||| |||||||||||| ||||||| |||||||||||||| ||||| || |
|
|
| T |
20998530 |
ctgtttggcgtttgatatgattaacgaagagagtgggaggattgtgatcactgacattgtgtgtaatttgttgagaactgtgatacatgctacaccggaa |
20998629 |
T |
|
| Q |
215 |
gatcttgttccggttgtttat |
235 |
Q |
| |
|
|||||||| || ||||||||| |
|
|
| T |
20998630 |
gatcttgtgcctgttgtttat |
20998650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University