View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2990_high_9 (Length: 242)
Name: NF2990_high_9
Description: NF2990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2990_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 19 - 162
Target Start/End: Original strand, 44749469 - 44749612
Alignment:
| Q |
19 |
gaataagctataggataagtttgctctaggttgattgcaaaatcttttattgtccatagtcatacattagatctataaaaaggacgtgaattagtttagt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44749469 |
gaataagctataggataagtttgctctaggttgattgcaaaatcttttattgtccatagtcatacattagatatataaaaaggacgtgaattagtttagt |
44749568 |
T |
 |
| Q |
119 |
ttgctcctataaaagacatggtctcattaatgctaaacgtataa |
162 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44749569 |
ttgctcatataaaagacatggtctcattaatgctaaacgtataa |
44749612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 193 - 242
Target Start/End: Original strand, 44749635 - 44749684
Alignment:
| Q |
193 |
aaagattcccctcacgttgttatcatgtctagaagcttcagtcataattt |
242 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44749635 |
aaagattctcctcacgttgttatcatgtctagaagcttcggtcataattt |
44749684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University