View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2990_low_14 (Length: 222)
Name: NF2990_low_14
Description: NF2990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2990_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 53; Significance: 1e-21; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 126 - 201
Target Start/End: Complemental strand, 26129592 - 26129516
Alignment:
| Q |
126 |
tttcactactaataaaaaccttcttccaccaattaatcatgacttattt-tcttataataattcaattaagtgataa |
201 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| | ||||||||||||||| || |||||| |
|
|
| T |
26129592 |
tttcactacttataaaaaccttcttccaccaattaatcatgacttatttatattataataattcaataaattgataa |
26129516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 68
Target Start/End: Complemental strand, 26129693 - 26129652
Alignment:
| Q |
27 |
gaatttatgctaccccatgccgttgaataaagtggaattact |
68 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26129693 |
gaatttatgctcccccatgccgttgaataaagtggaattact |
26129652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 40
Target Start/End: Original strand, 26135170 - 26135198
Alignment:
| Q |
12 |
gagatgaagttgggagaatttatgctacc |
40 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26135170 |
gagatgaagttgggagaatttatgctacc |
26135198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University